previous arrow
next arrow
Slider
Hématologie-oncologie

Hémorragie hypophysaire et panhypopituitarisme au cours de l’infection par le virus Puumala: imagerie par résonance magnétique et détection de l’antigène viral dans l’hypophyse

L’autopsie a révélé une hypophyse hémorragique positive pour l’antigène du virus Puumala dans les cellules endothéliales stromales et vasculaires neuroendocrines du patient, et les patients ont développé une hémorragie hypophysaire diagnostiquée par imagerie par résonance magnétique pendant ou peu de temps après NE aiguë, les deux ont développé panhypopituitarisme

irus On pense que la transmission à l’homme se produit par inhalation d’excréments aérosolisés de rongeurs infectés et, sans surprise, les agriculteurs ont un risque professionnel accru d’infection par le virus Puumala Après une période d’incubation de – semaines a une apparition aiguë typique accompagnée de fièvre, de céphalées, de douleurs abdominales, de nausées, de diarrhée, de signes d’atteinte rénale et, dans un tiers des cas, de myopie aiguë En plus des résultats typiques de laboratoire incluant une protéinurie et la thrombocytopénie, le diagnostic repose sur la détection d’anticorps IgM ou d’anticorps IgG anti-avidité du sérum de Puumala La guérison spontanée est typique chez les patients NE, bien que des décès aient été sporadiquement rapportés NE révèlent une variété de complications rares, y compris l’encéphalite, les convulsions, le syndrome de Guillain-Barré, les hémorragies dans divers organes, la rupture des reins et la pancréatite [,,] est la susceptibilité génétique pour les cours sévères de NE, avec la survenue d’un choc et d’une lésion rénale sévère associée à l’antigène leucocytaire B. B haplotype Une hémorragie hypophysaire et un panhypopituitarisme associés à NE ont été rapportés ailleurs [,,] Le mécanisme de l’hémorragie reste incertain, bien qu’il ait été démontré que les hantavirus infectent spécifiquement les cellules endothéliales et interagissent avec les intégrines ß présentes sur les plaquettes Il est possible que les complications dans les cas rapportés ailleurs soient dues à un choc hypovolémique au cours du stade thrombocytopénique de la maladie. est, à notre connaissance, le premier rapport de preuve de l’invasion directe du virus Puumala de l’hypophyse En outre, nous rapportons à la fois l’utilisation de l’IRM pour le diagnostic d’hémorragie hypophysaire et le développement de panhypopituitarisme pendant ou peu après le rapport NECase aiguë. agriculteur de sexe masculin ayant déjà souffert d’hypertension et qui avait des antécédents de fièvre aiguë aiguë Il a eu une courte période de saignement nasal avant l’admission. Il prenait du bisoprolol mg / jour et de l’hydrochlorthiazide mg / jour pour sa tension artérielle, qui était sous contrôle adéquat. À l’hôpital, le patient était dans un état stable et avait une température de ° C et aucun signe d’œdème, de détresse respiratoire ou de douleur thoracique. Sa fréquence cardiaque était de battements / min et sa pression artérielle était de mm Hg. noté dans les sondes électrocardiographiques inférolatérales Les études en laboratoire ont révélé les valeurs suivantes: hémoglobine, g / L; Nombre de globules blancs, × cellules / L; numération plaquettaire, × plaquettes / L; créatinine sérique, μM; et la protéine C-réactive, mg / L Urinalysis a révélé proteinuria et pyuriaThérapie avec céfuroxime intraveineux et fluides a été initiée, et l’état du patient était stable jusqu’au lendemain matin, quand il a développé une vision floue, oligurie et hypotonie pression artérielle nadir, mm Hg Il a éprouvé une détresse respiratoire transitoire, pour laquelle il a nécessité l’utilisation temporaire d’un masque à oxygène. Sa fréquence cardiaque était de battements / min, et l’inversion des ondes t en électrocardiographie est restée inchangée. l’œil gauche pendant la TDM L’échographie abdominale a révélé un œdème vésiculaire non spécifique de la vésicule biliaire Des études en laboratoire ont révélé les valeurs suivantes: hémoglobine, g / L; WBC, × cellules / L; numération plaquettaire, × plaquettes / L, créatinine sérique, μM; sodium, mM; potassium, mM; et la protéine C réactive, les anticorps du sérum Puumala mg / L étaient positifs avec une faible avidité IgG, ce qui est compatible avec NEBy aiguë le soir du deuxième jour d’hospitalisation, l’état du patient s’était amélioré, et il était fréquemment surveillé. symptômes respiratoires ou des douleurs thoraciques, et sa pression artérielle est restée μ / mm Hg Il a continué à avoir une forte fièvre et une faible production d’urine, ce qui est typique pour la phase précoce de NE inattendue, il a été trouvé sur son lit, ne répond pas; En raison de la mort inattendue, une autopsie médico-légale avec examens microscopiques et sérologiques a été effectuée. La glande pituitaire du patient était légèrement agrandie et présentait des signes d’hémorragie et de nécrose. La glande et la dure-mère avaient une infiltration granulocytaire, les gyri- Les reins présentaient une nécrose tubulaire proximale aiguë avec infiltration de protéines dans les tubules collecteurs et de petites hémorragies dans les glomérules. Aucun infiltrat cellulaire inflammatoire n’a été observé dans les reins. Le foie avait des infiltrats lymphocytaires dans les zones portales et de petits foyers nécrotiques dans le parenchyme hépatique. le foie, la rate, les reins et les poumons avaient une congestion veineuse. Le coeur était légèrement hypertrophié et le myocarde était fibrotique. Il n’y avait aucun signe d’ischémie aiguë dans le myocarde, bien que les artères coronaires étaient calcifiées et modérément sténosées.

Figure Vue largeTélécharger une coupe du lobe antérieur du patient de la glande pituitaire La glande est nécrotique, hémorragique et infiltrée de cellules polymorphonucléaires Dura et l’espace sous-dural sont également infiltrés de cellules inflammatoires Aucune cellule néoplasique n’a été trouvée Hématoxyline-éosine; grossissement d’origine, × Figure Agrandir la photoLecture du lobe antérieur du patient de la glande pituitaire La glande est nécrotique, hémorragique et infiltrée de cellules polymorphonucléaires Dura et l’espace sous-dural sont également infiltrés de cellules inflammatoires Aucune cellule néoplasique n’a été trouvée Hématoxyline-éosine; grossissement original, × La détection de l’antigène du virus Puumala a été réalisée en utilisant des coupes de tissus fixés au formol et inclus en paraffine, obtenus à partir d’échantillons de rein, coeur, foie, rate, cerveau et hypohyse du patient. pulmonaires et spléniques, ainsi que des échantillons d’hypophyse chez l’homme. La protéine PUU-N du virus Puumala a été détectée avec un antisérum de lapin dirigé contre la protéine de fusion PUU-N glutathion S-transférase recombinante à: ou: dilutions, Ventana Medical Systems pour l’analyse immunohistochimique La détection était basée sur la méthode avidine-peroxydase avec utilisation d’anticorps secondaires biotinylés. Les substrats de peroxydase utilisés pour la visualisation étaient: – diaminobenzidine Ventana Medical Systems dans des échantillons d’hypophyse et Ventana Medical Systems rouge rapide dans des échantillons de rein La contre-coloration a été réalisée avec de l’hématoxyline et la coloration post-comptage a été réalisée avec un réactif de coloration M de carbonate de lithium en M de carbonate de sodium Des échantillons de sérum préimmun, un anticorps monoclonal anti-GST B- Santa Cruz Biotechnology et un diluant d’anticorps comme anticorps primaire ont été utilisés pour contrôler la coloration non spécifique. Des cellules colorées positivement ont été observées dans le lobe antérieur hypophyse A, les tubules rénaux figure D, et les données de rate non montrées du patient par l’utilisation de l’antisérum N-spécifique du virus de Puumala; aussi, la couche de cellules endothéliales de certains vaisseaux sanguins dans l’hypophyse était positive pour l’antigène N du virus Puumala figure B Aucune réaction n’a été observée dans les échantillons témoins ou dans les coupes de tissus obtenues du patient en utilisant le sérum préimmun C, sections tissulaires du patient cérébral le cortex, le cœur et le foie étaient négatifs pour les données sur l’antigène du virus Puumala non montrées

Les cellules ndotheliales F étaient également positives pour la protéine N du virus Puumala dans l’hypophyse B. Le même tissu coloré avec le sérum préimmun était négatif C, comme l’était un échantillon de tissu hypophyse témoin incubé avec le sérum spécifique au virus Puumala-N. Le type cellulaire infecté par le virus Puumala dans l’hypophyse a été défini en colorant des coupes en série de l’échantillon de tissu pour les marqueurs spécifiques du type de cellule chromogranine pour les cellules neuroendocrines, CD. Les cellules infectées ont été identifiées comme étant des cellules endocrines positives à la chromogranine ou des cellules endothéliales positives à la CD-figure F, c’est-à-dire que la preuve de l’infection des deux types de cellules a été identifiée. La détection de l’ARN du virus Puumala a été réalisée à l’aide de la PCR de la transcriptase inverse L’ARN de la RT-PCR a été extrait de la matrice de paraffine Des échantillons ont été prélevés en utilisant le kit d’isolation ARN de paraffine Block Ambion, selon le protocole du fabricant RT-PCR et PCR nichée ont été réalisées comme décrit ailleurs , avec des amorces légèrement modifiées: pour RT-PCR, CCGA / GTCCACCAACATG et CTA / GAGTTCCGGA / GTCCATATC; Les échantillons PCR de GAGCTTGGGGCCTTTTTTTC et GATCTACCATTTCTTTA / GCCCCATTC ont été analysés sur des gels d’agarose, purifiés sur gel et directement séquencés. Des échantillons hypophysaires, rénaux, pulmonaires et spléniques étaient positifs pour l’ARN viral, tandis que les échantillons de cortex cérébral, de cœur et de foie restaient négatifs Le numéro d’accès à la séquence nucléotidique récupérée était identique à d’autres séquences du virus Puumala, dont la plus proche provenait de Finlande. L’analyse phylogénétique a placé cette séquence dans la lignée du virus Puumala finlandais avec des données de soutien bootstrap élevées non montrées. La patiente était auparavant en bonne santé. vieux fermier qui avait des nausées, des maux de tête, de la transpiration, des vomissements et de la fièvre, ° C pendant plusieurs jours avant son admission à l’hôpital en mars À l’admission, son état était stable, sans oedème ni détresse respiratoire. : hémoglobine, g / L; Nombre de globules blancs, × cellules / L; numération plaquettaire, × plaquettes / L; créatinine sérique, μM; Au cours de la deuxième journée d’hospitalisation, il a développé une anurie, une hypotonie et un œdème. Son taux sérique de créatinine a culminé à μM le jour de l’hospitalisation, suivi d’une récupération spontanée complète du rein. Il a développé un épanchement pleural et un œdème pulmonaire résolu spontanément le jour de l’hospitalisation. Le nombre de plaquettes de nadir était de * plaquettes / L, et le taux d’hémoglobine a atteint un pic de g / L jour après l’hospitalisation. anémie avec un taux d’hémoglobine de g / L Le résultat de l’analyse des anticorps anti-virus Puumala était positif avec une faible avidité IgG, suggérant un diagnostic d’hépatite aiguë. Le patient a été sorti de l’hôpital quelques jours après son admission. En août, le patient se plaignait d’avoir de la fatigue et il avait graduellement perdu du poids et était incapable de retourner au travail. La ville avait diminué drastiquement après sa première hospitalisation Il dormait μ h par nuit, continuellement froid, éprouvait une perte de libido et avait un faible volume de spermatozoïdes L’anémie ne s’était pas améliorée, malgré l’utilisation de suppléments de fer. son état général a été jugé bon et aucune observation clinique évidente n’a été notée, bien que ses testicules aient été signalés comme étant plus petits que la normale. Les études en laboratoire ont révélé les valeurs suivantes: sodium sérique, mM; potassium sérique, mM; osmolalité sérique, mOsm / kgH; le cortisol sérique, μM; valeur de référence normale, – μM; hormone adrénocorticotrope, ng / L normal, – ng / L; hormone thyroïdienne libre T, pM normale, – pM; hormone sérique stimulant la thyroïde, mU / L normal, – mU / L; testostérone sérique, nM normal, – nM; hormone lutéinisante sérique LH, U / L normal, & lt; U / L; la prolactine sérique, & lt; μg / L normal, & lt; μg / L; et hormone folliculo-stimulante sérique, U / L normal, & lt; Sur la base des résultats hormonaux, le panhypopituitarisme a été diagnostiqué et un traitement substitutif par l’hydrocortisone, la thyroxine et la testostérone a commencé. Son état ne s’est pas amélioré au cours du suivi. L’IRM cérébrale a révélé une hypertrophie de l’hypophyse avec hématome hypophysaire. examen de suivi des mois après la sortie de l’hôpital, les hémorragies ont été jugées très inchangées; quelques mois après la sortie, il ne restait que de petites traces d’hémorragie, et la glande était de plus petite taille, avec un côté gauche proéminent. Lors des examens de suivi annuels, la glande était grossièrement inchangée. Le côté gauche restait proéminent et non envahissant; du point de vue de l’imagerie, un adénome ne pouvait pas être exclu

ull conscience Sa fonction rénale s’est rétablie et les épanchements pleuraux ont été résolus Les études de laboratoire ont révélé les valeurs suivantes: sérum libre T, pM normal, – pM; hormone sérique stimulant la thyroïde, mU / L normal, – mU / L; testostérone sérique, nM normal, – nM; prolactine sérique, mU / L normal, & lt; mU / L; facteur de croissance analogue à l’insuline sérique, nM normal, – nM; Après un test standard de stimulation hormonale corticosurrénalienne avec mg de cosyntropine, son taux de cortisol sérique min après la prise du médicament était de μM. Sur la base de ces résultats, le panhypopituitarisme a été diagnostiqué et le patient a commencé à recevoir le cortisol basal. Dans les études d’IRM de suivi effectuées et les mois après la sortie de l’hôpital, les changements hémorragiques dans l’hypophyse diminuaient graduellement, et la taille de la glande diminuait à une taille normale ou légèrement inférieure à la normale. plus homogène et était presque normal dans le dernier examen Son panhypopituitarism n’a montré aucun signe de rétablissementDiscussio Des rapports antérieurs de grave NE ont décrit l’hémorragie hypophysaire associée à l’infection par le virus Puumala et Hantaan [,,,] Valtonen et al ont rapporté des cas mortels; tous les patients présentaient une hémorragie et une nécrose dans leurs glandes hypophysaires. Cependant, dans ces cas et dans des rapports publiés ailleurs, le mécanisme d’hémorragie pouvait être un choc hypovolémique, comme chez les mères atteintes du syndrome de Sheehan après accouchement compliqué. signe d’un œdème pulmonaire ou tachycardie, et sa pression artérielle systolique est restée μ mm Hg analyse post-mortem de son hypophyse a démontré infection au virus Puumala, qui a confirmé qu’il y avait une invasion virale directe, y compris l’infection des cellules neuroendocrines Il est possible que l’hémorragie chez ce patient a été causée par une atteinte virale directe dans le cerveau pendant la phase thrombocytopénique de la maladie L’augmentation de la pression intracrânienne, des perturbations des électrolytes ou de l’arythmie cardiaque a peut-être contribué au mécanisme de la mort. Le rôle de l’infection des cellules neuroendocrines avec Puumala le virus dans le développement des insuffisances hormonales hypophysaires reste à élucider Le virus Puumala a également été détecté dans les tubules rénaux; bien que cela ait été démontré ailleurs pour d’autres hantavirus qui causent une fièvre hémorragique plus grave avec syndrome rénal , peu de rapports avec des résultats clairs sont disponibles concernant le virus Puumala. L’ARN viral a été détecté par RT-PCR dans l’hypophyse, le rein, pulmonaires, et des échantillons de tissu splénique, et sa séquence était unique, différant des souches du virus Puumala précédemment caractérisées avec un degré de variation géographique typique. Les données confirment davantage l’association des résultats antigène et anticorps avec l’infection aiguë au virus Puumala. L’IRM du virus Puumala dans les leucocytes et les sédiments urinaires a été détectée au cours des premiers jours de maladie aiguë seulement. L’IRM a été utilisée pour le diagnostic des patients et a montré un développement de panhypopituitarisme après une hémorragie hypophysaire pendant ou peu après l’apoplexie hypophysaire aiguë. glandes Du point de vue de l’imagerie, il peut être impossible d’exclure un adénome, comme p La taille stable de la zone de non-gonflement proéminente de l’hypophyse rend l’adénome improbable, suggérant qu’elle est probablement causée par des changements posthémorragiques dans la glande. La glande hypophysaire est très vulnérable en raison de sa localisation anatomique et de l’organisation de l’irrigation sanguine. de la glande pituitaire reçoit seulement% -% de son approvisionnement sanguin des artères hypophysaires supérieures et inférieures, tandis que le% -% restant est fourni par la circulation portale veineuse hypophysaire Maux de tête, fatigue, rigidité nucale, confusion, vomissements et autres signes de participation du SNC sont très fréquents pendant et après le NE Il est possible que l’hypopituitarisme dû à l’hypophyse affectée soit plus fréquent qu’on ne le pense actuellement, et que la lésion soit envisagée dans tous les cas d’insuffisance rénale sévère. varient de aiguë à subaiguë dans les symptômes, les signes et les résultats Il est possible que le diagnostic de panhypopituitarisme peut être difficile à faire dans les cas bénins, en particulier si une longue période s’est écoulée depuis que les infections aiguës au virus NE Puumala sont fréquentes en Finlande% de séroprévalence dans la population générale,% dans les zones d’endémicité et jusqu’à% dans les cohortes de personnes âgées , le fardeau d’éventuelles séquelles à long terme ou d’une diminution de la qualité de vie peut être significatif Le présent rapport de cas suggère qu’un dysfonctionnement hypophysaire mineur chez les patients avec NE peut être commun, et donc une étude systématique pour estimer la fréquence de cette complication devrait être entreprise

Remerciements

Nous remercions Irina Suomalainen au Haartman Institute Helsinki et le personnel des départements de Radiologie diagnostique, de médecine légale et de laboratoire photographique de Oulu, Finlande, pour leur expertise technique. Nous remercions également Anders Paetau, pour ses expertises en neuropathologie, et Kristina von Boguslawsky, pour une aide technique dans des expériences de coloration en série

Back To Top